Review



e2621 software graphpad prism 9  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    New England Biolabs e2621 software graphpad prism 9
    E2621 Software Graphpad Prism 9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9349 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e2621+software+graphpad+prism+9/NEBuilder+HiFi+DNA+Assembly+Master+Mix/pm41872551-248-303-298
    Average 99 stars, based on 9349 article reviews
    e2621 software graphpad prism 9 - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    Recombinant:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    Sequencing:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    Real-time Polymerase Chain Reaction:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    Transfection:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    SYBR Green Assay:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    Reverse Transcription:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    TA Cloning:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.

    Software:

    Article Title: TPGS1 regulates central spindle microtubule glutamylation and remodeling during telophase and abscission.
    Article Snippet: © The Author(s) EMBO reports 15 Reagent/resource Reference or source Identifier or catalog number pTTLL7-EYFP Gift from Dr. Carsten Janke pTTLL11-EYFP Gift from Dr. Carsten Janke pCCP1-EYFP Gift from Dr. Carsten Janke pCCP5-EYFP Gift from Dr. Carsten Janke pEYFP-N3 Clontech pEGFP-N3 Clontech pTTLL1-E326GEGFP This study pTPGS1-EYFP3’UTR This study Antibodies Mouse anti-αtubulin (B512) Invitrogen Cat # 32-2500, IF 1:100 WB 1:1000 Rabbit anti-αtubulin Abcam Cat # AB15246, 1:100 Rabbit antiAcetylated Tubulin (K40) Cell Signaling Cat #5335, 1:200 Mouse antiAcetylated Tubulin Sigma-Aldrich Cat #T7451, 1:500 Mouse recombinant antiGT335 Gift from Dr. Kristen Verhey Cite, 1:100 Rabbit anti-PolyE (IN105) AdipoGen Cat # AG-25B-0030, 1:100 Rabbit anti-PRC1 Protein Tech Cat # 15617-1-AP, 1:100 Mouse anti-Spastin (1:100) (Santa Cruz, sc-53443) Santa Cruz Cat # sc-53443, 1:100 Rabbit anti-p60 katanin Abcam Cat# AB111881, 1:100 Hoechst 3342 AnaSpec Cat # AS-83218, 1:5000 Alexa-488 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-545-152, 1:100 Alexa-594 AntiMouse Secondary Jackson ImmunoResearch Cat #715-585-150, 1:100 Alexa-488 AntiMouse Secondary Jackson ImmunoResearch Cat # 715-545-150, 1:100 Alexa-594 AntiRabbit Secondary Jackson ImmunoResearch Cat # 711-585-152, 1:100 IRDye 680RD antimouse Secondary Li-cor Cat #926-68072, 1:10,000 IRDye 800CW antirabbit Secondary Li-cor Cat #926-32213, 1:10,000 Oligonucleotides and other sequence-based reagents TPGS1 qPCR Forward This study CGGCGTGACGGAAATGCTA TPGS1 qPCR Reverse This study CCATGTTCTCGAAGTAGTGAGC Reagent/resource Reference or source Identifier or catalog number TTLL1 qPCR Forward This study GCTCTCACAGATCAAAAAGTGGT TTLL1 qPCR Reverse This study CCGCCAATTAGTAACGGGTTG GAPDH qPCR Forward This study CTGGGCTACACTGAGCACC GAPDH qPCR Reverse This study AAGTGGTCGTTGAGGGCAATG Chemicals, enzymes, and other reagents Phusion HighFidelity DNA Polymerase New England Biolabs Cat #M0530S Lipofectamine Transfection Reagent Invitrogen Cat # 18324012 tracrRNA Horizon Discovery Cat #U-002005-xx DharmaFECT Duo transfection reagent Horizon Discovery Cat #T-2010-xx iTaq Universal SYBR Green Bio-Rad Cat # 1725120 SuperScript VI Reverse Transcriptase Invitrogen Cat # 18090010 The Original TA Cloning Kit Invitrogen Cat # K202020 NEBuilder HiFi DNA Assembly New England Biolabs Cat # E2621 Software GraphPad Prism 9 https://www. graphpad.com/ FIJI https://imagej. net/ij/index.html Adobe Illustrator Adobe Inc.



    Similar Products

    e2621 software graphpad prism 9  (New England Biolabs)
    99
    New England Biolabs e2621 software graphpad prism 9
    E2621 Software Graphpad Prism 9, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e2621+software+graphpad+prism+9/NEBuilder+HiFi+DNA+Assembly+Master+Mix/pm41872551-248-303-298
    Average 99 stars, based on 1 article reviews
    e2621 software graphpad prism 9 - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results